View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5478_low_52 (Length: 282)
Name: NF5478_low_52
Description: NF5478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5478_low_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 13 - 264
Target Start/End: Original strand, 2894980 - 2895231
Alignment:
| Q |
13 |
cagacttaaccgaagggccgtcatttgatctacatcaggtatatatgatgaacaaccagatgaagtctcaaaatagattatttcattccatcaagaagag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2894980 |
cagacttaaccgaagggccgtcatttgaactacatcaggtatatatgatgaacaaccagatgaagtctcaaaatagattatttcattccatcaagaagag |
2895079 |
T |
|
| Q |
113 |
cttttctcaaaatatttgtgtaaacacattggtgttcacttggctcaatagcgcttcaggagttgattcgattttttattttgggtagacatgctttatt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2895080 |
cttttctcaaaatatttgtgtaaacacattggtgttcacttggctcaatagcgcttcaggagttgattcgattttttattttgggtagacatgctttatt |
2895179 |
T |
|
| Q |
213 |
tttctttcaaattgctgtggtccaaaagcaagaggatataattactacatat |
264 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2895180 |
tttcttgcaaattgctgtggtccaaaagcaagaagatataattactacatat |
2895231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University