View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5478_low_65 (Length: 255)
Name: NF5478_low_65
Description: NF5478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5478_low_65 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 52 - 214
Target Start/End: Complemental strand, 2786326 - 2786164
Alignment:
| Q |
52 |
aaatcaaagccatctacaatgctggagctgtcaatccacctgttgatgcgaaaccccctcttgttttgatatcagaaggtttcagggaagcccgcactgc |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2786326 |
aaatcaaagccatctacaatgctggagctgtcaatccaccggttgatgctaaaccccctcttgttttgatatcagaaggtttcagggaagcccgcactgc |
2786227 |
T |
 |
| Q |
152 |
cttgagtccttccggaacaacaaacttgccttcaaatcaaattcatgttaaagttgatgatgt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2786226 |
cttgagtccttccggaacaacaaacttgccttcaaatcaaattcatgttaaagttgacgatgt |
2786164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 110 - 159
Target Start/End: Original strand, 22518232 - 22518281
Alignment:
| Q |
110 |
tcttgttttgatatcagaaggtttcagggaagcccgcactgccttgagtc |
159 |
Q |
| |
|
|||| |||| |||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
22518232 |
tcttattttaatatcagaaggttttagggaagcccgcagtgccttgagtc |
22518281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University