View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5478_low_67 (Length: 254)
Name: NF5478_low_67
Description: NF5478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5478_low_67 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 18911469 - 18911711
Alignment:
| Q |
1 |
cttggtagccaaatacctcaattagtcttttcctacttcgagcatcccatatggtagcataaccttcatcatcaccagtgacaaatgcaccagacatact |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18911469 |
cttggtaggcaaatacctcaattagtcttttcctacttcgagcatcccatatggtagcataaccttcatcatcaccagtgacaaatgcaccagacatact |
18911568 |
T |
|
| Q |
101 |
aatagaaattatatgaatcaaatttccaatttttataatttaggataatttaaatggcaatttaatgatgataagacgaaacatacagtggactaaatgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18911569 |
aatagaaattatatgaatcaaatttccaatttttataatttaggataatttaaatggcaatttaatgatgataagacgaaacatacagtggactaaatgc |
18911668 |
T |
|
| Q |
201 |
aatgtcgttcacagatgccaaatgatgctgaccatcctttgat |
243 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18911669 |
aatgttgttcacagatgccaaatgatgctgaccatcctttgat |
18911711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University