View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5478_low_70 (Length: 250)
Name: NF5478_low_70
Description: NF5478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5478_low_70 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 2 - 241
Target Start/End: Complemental strand, 16460046 - 16459802
Alignment:
| Q |
2 |
tagaatgataatgattttccattttaatgtaccagttattaaag-aaatcgattgttgttattatgtttatgaagtttgaattttccagattattattaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16460046 |
tagaatgataatgattttccattttaatgtaccagtcattaaagtaaatcgattgttgttattatgtttatgaagtttgaattttccagattattattaa |
16459947 |
T |
|
| Q |
101 |
tatcctacttcactttaatttgtcgatgtgttactcttctttggcatgatt----tatatggtgtttgctttatttggaacttttagtttggtgcaatta |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16459946 |
tatcctacttcactttaatttgtcgatgtgttactcttctttggcatgatttacatatatggtgtttgctttatttggaacttttagtttggtgcaatta |
16459847 |
T |
|
| Q |
197 |
atcttccatctaggccaaaatagaaaattaacttaggcacctatg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16459846 |
atcttccatctaggccaaaatagaaaattaacttatgcacctatg |
16459802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University