View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5478_low_71 (Length: 250)
Name: NF5478_low_71
Description: NF5478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5478_low_71 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 98 - 196
Target Start/End: Complemental strand, 29831934 - 29831831
Alignment:
| Q |
98 |
agaggatagtatacatgttgaatgg-----acacaaattattctttgctgtttgattcgagaccagtgtcaactgcatgggataagttgaagtcagccac |
192 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
29831934 |
agaggatagtatacatgttgaatgggtcagacacaaattattctttgctgtttgattcgagacccgtgtcaactgcatgggataagttgaagtcaaccac |
29831835 |
T |
 |
| Q |
193 |
cgac |
196 |
Q |
| |
|
|||| |
|
|
| T |
29831834 |
cgac |
29831831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University