View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5478_low_75 (Length: 247)
Name: NF5478_low_75
Description: NF5478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5478_low_75 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 40661983 - 40661843
Alignment:
| Q |
1 |
cattggcgagtttgcttcgactttgagaaagaaaggaaaatatat--taaagatttgattcctatgtaannnnnnngtatagcttgtttagttttatttt |
98 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40661983 |
cattggcgaggttgcctcgactttgagaaagaaaggaaaatatatattaaagatttgattcctatgtaacttttt-gtatagcttgtttagttttatttt |
40661885 |
T |
 |
| Q |
99 |
ggggaaaatacactaacctcccctaaggtttatctaaatgta |
140 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40661884 |
ggggaaaatacactaaactcccctaaggtttatctaaatgta |
40661843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University