View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5478_low_77 (Length: 244)
Name: NF5478_low_77
Description: NF5478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5478_low_77 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 336088 - 335870
Alignment:
| Q |
1 |
aactcaaatcctagaatagttttgtcttcattggtctttttatgtgaaaataaaaaatgcaagttggaattggaaataaatggttataggcatagaaggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
336088 |
aactcaaatcctagaatagttttgtcttcattggtctttttatgtgaaaatcaaaattgcaagttggaattggaaataaatggttataggcatagaaggt |
335989 |
T |
|
| Q |
101 |
aaagagagagaaatccacaaaacaaaacacaagaaggcattgacatcacatgctataatatatagacagcgatgcactgtgtaaacctggtaaacgtcca |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
335988 |
aaagagagagaaatccacaaaacaacacacaagaaggcattgacatcacatgc-----tatatagacagcgatgcactgtgtaaacctggtaaacgtcca |
335894 |
T |
|
| Q |
201 |
cttcccattccattacactgtatg |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
335893 |
cttcccattccattacactgtatg |
335870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University