View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5478_low_87 (Length: 235)
Name: NF5478_low_87
Description: NF5478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5478_low_87 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 11 - 220
Target Start/End: Original strand, 52511177 - 52511386
Alignment:
| Q |
11 |
tcattttgttctttgcttcttctggttaccaacttcaaaatcatttgttgaggaggttttccttgaagattggaatgggatggaggtggttttagcattc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52511177 |
tcattttgttctttgcttcttctggttaccaacttcaaaatcatttgttgaggaggttttccttgaagattggaatgggatggaggtggttttagcattc |
52511276 |
T |
 |
| Q |
111 |
ttattgcagctggtgaagctctgcatcaccataggctttgtagtggcaacccaaggatcaccaggtatgtgcttgcttaatcttcacgttttgttgagat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52511277 |
ttattgcagctggtgaagctctgcatcaccataggctttgtagtggcaacccaaggatcaccaggtatgtgcttgcttaatcttcacgttttgttgagat |
52511376 |
T |
 |
| Q |
211 |
tgatcctttg |
220 |
Q |
| |
|
|||||||||| |
|
|
| T |
52511377 |
tgatcctttg |
52511386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University