View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5478_low_93 (Length: 222)
Name: NF5478_low_93
Description: NF5478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5478_low_93 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 41289361 - 41289157
Alignment:
| Q |
1 |
atatgccagcttccaaaataattcacacacgcagaaactggtcaattatgcaatttcagtcaactgtctaaaatatacccaactatacacagtgaatcgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41289361 |
atatgccagcttccaaaataattcacacacgcagaaactggtcaattatgcaatttcaatcaactgtctaaaatatacccaactatacacagtgaatcgc |
41289262 |
T |
 |
| Q |
101 |
taatttagtccctaaagttatagagtcgaacaactttttcttttggtttctcataggttccctcttcaatagttgtaattttattcgagaaactctcact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41289261 |
taatttagtccctaaagttatagagtcgaacaactttttcttttggtttctcataggttccctcttcaatagttgtaattttattcgagaaactctcact |
41289162 |
T |
 |
| Q |
201 |
aaatg |
205 |
Q |
| |
|
||||| |
|
|
| T |
41289161 |
aaatg |
41289157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University