View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5478_low_99 (Length: 209)
Name: NF5478_low_99
Description: NF5478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5478_low_99 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 19 - 195
Target Start/End: Complemental strand, 29583540 - 29583364
Alignment:
| Q |
19 |
ctttgcacccttcaaatatttgcttaactaataattgcacctcttcttctcgaacttctgtgaacatcgcaagacgattggtggagaaaagttctgttgt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29583540 |
ctttgcacccttcaaatatttgcttaactaataattgcacctcttcttctcgaacttttgtgaacatcgcaagacgattggtggagaaaagttctgttgt |
29583441 |
T |
 |
| Q |
119 |
tgttaaacgacgtagtttgcgatgaagttcaccgtagggagaaaaccctaacgccgtattattgtaattgagatatt |
195 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29583440 |
tgttaaacgacgcaatttgcgatgaagttcaccgtagggagaaaaccctaacgccgtattattgtaattgagatatt |
29583364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University