View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5479_low_12 (Length: 239)
Name: NF5479_low_12
Description: NF5479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5479_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 14 - 224
Target Start/End: Original strand, 3350304 - 3350513
Alignment:
| Q |
14 |
caaaggaaatacacttagttggtagtatttttattaaataggttgcaattatagtattttctaattgaaaccaaaagaaaaattaaaagtgtactagaag |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3350304 |
caaaggaaatacacttagttggtagtatttt-attaaataggttgcaattatagtattttctaattgaaaccaaaagaaaaattaaaagtgtactagaag |
3350402 |
T |
 |
| Q |
114 |
taactttgtggcatcctatgtaggaataacaccatcaattgggtatgttaaagaagaaagaatgatagagaaagttatgttatcttaaaatccagtggca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3350403 |
taactttgtggcatcctatgtaggaataacaccatcaattgggtatgttaaagaagaaagaatgatagagaaagttatgttatcttaaaatccagtggca |
3350502 |
T |
 |
| Q |
214 |
tctaagtatct |
224 |
Q |
| |
|
||||||||||| |
|
|
| T |
3350503 |
tctaagtatct |
3350513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University