View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5479_low_13 (Length: 234)
Name: NF5479_low_13
Description: NF5479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5479_low_13 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 21 - 234
Target Start/End: Original strand, 34144236 - 34144449
Alignment:
| Q |
21 |
tcttttctatcccacaatccaaatttagaagcgtatgaggtatcccctgagcccaatacttcttcaaacataggatcattgttaaaaatggcagcatcat |
120 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34144236 |
tcttttctatccaacaatccaaatttagaagcgtatgaggtatcccctgagcccaacacttcttcaaacataggatcattgttaaaaatggcagcatcat |
34144335 |
T |
|
| Q |
121 |
ttagatatacatgatttcttatgtaagatgtgtcttctgatgtgcgcggacatttgacgcttctatccacattaccattttctgaaacaacttctacgct |
220 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34144336 |
ttagatatacatggtttcttatgtatgatgtgtcttctgatgtgcgcggacatttgacgcttctatccacattaacattttctgaaacaacttctacgct |
34144435 |
T |
|
| Q |
221 |
atttggtgttcctc |
234 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
34144436 |
atttggtgttcctc |
34144449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University