View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5479_low_5 (Length: 298)
Name: NF5479_low_5
Description: NF5479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5479_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 18 - 281
Target Start/End: Original strand, 2467765 - 2468028
Alignment:
| Q |
18 |
ctcacttatatcctcttccattttcccccctcctactcctcgctgcaatctcaaattaccaccacgctttcaattcaccaacatttttcgggctacaacg |
117 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2467765 |
ctcacttatatcctcttccatttttccccctcctactcctcgctgcaatctcaaattaccaccacgctttcaattcaccaacatttttcggtctacaacg |
2467864 |
T |
 |
| Q |
118 |
gtaatttcctgaacctatcttcaacttcatttcattcaattcaatgcctcaaatttattttcattttcgtatagggattcgttcgtgcttccgaggatga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2467865 |
gtaatttcctgaacctatcttcaacttcatttcattcaattcaatgcctcaaatttattttcattttcgtatagggattcgttcgtgcttccgaggatga |
2467964 |
T |
 |
| Q |
218 |
ctctgttgccgaaaattccgattctcaatgccaattggcaacacagaatgtgtcttctgatgat |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2467965 |
ctctgttgccgaaaattccgattctcaatgccaattggcaacacagaatgtgtcttctgatgat |
2468028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University