View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5479_low_7 (Length: 264)
Name: NF5479_low_7
Description: NF5479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5479_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 16 - 233
Target Start/End: Complemental strand, 39786014 - 39785796
Alignment:
| Q |
16 |
ataagaatgaaatggcgtatatactaattgccttaagatttttcgtaaagatgtgatgtcaaatt-ctatttgtgtggttgatcttggcctaatgtgacg |
114 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39786014 |
ataagaatgagatggcgtatataccaattgccttaagatttttcgtaaagatgtgatgtcaaatttctatttgtgtggttgatcttggcctaatgtgacg |
39785915 |
T |
 |
| Q |
115 |
atcttcgacttccctcataaccaaactatggtatttgagccgatgctttgactgactcgttgtatcgtaagtcttcataatcaaggcgattaggggactg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39785914 |
atcttcgacttccctcataaccaaactatggtatttgagctgatgctttgactgactcgttgtatcgtaagtcttcataatcaaggcgattaggggactg |
39785815 |
T |
 |
| Q |
215 |
tcccattgatggagcaagc |
233 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
39785814 |
tcccattgatggagcaagc |
39785796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 63 - 109
Target Start/End: Original strand, 24173625 - 24173671
Alignment:
| Q |
63 |
aagatgtgatgtcaaattctatttgtgtggttgatcttggcctaatg |
109 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
24173625 |
aagacgtgatgtcaaattctctttgtgtggttgatcttgacctaatg |
24173671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University