View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5480_high_4 (Length: 215)
Name: NF5480_high_4
Description: NF5480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5480_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 57; Significance: 6e-24; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 95 - 214
Target Start/End: Complemental strand, 25559543 - 25559427
Alignment:
| Q |
95 |
agagggagagagaggcgcgattgaagatgatgaagaaccctaattttgggttttttgttatgaaaccaagccttatatacgtgtcacggtggagccacat |
194 |
Q |
| |
|
|||| |||||||||||||||||||| | | |||||||||||||||||||||| || ||||| | | |||||||||||||| ||||||| |||||||| |
|
|
| T |
25559543 |
agagagagagagaggcgcgattgaatttca--aagaaccctaattttgggttttctgatatgag-caatgccttatatacgtgccacggtgtagccacat |
25559447 |
T |
|
| Q |
195 |
aggatcgtccacgtgtgcaa |
214 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
25559446 |
aggatcgtccacgtgtgcaa |
25559427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 20 - 81
Target Start/End: Complemental strand, 25559665 - 25559604
Alignment:
| Q |
20 |
gattgacccagaggattgcttcagattcgaattgaaggaattggattttggggtttgaattc |
81 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| || |||||||||| ||||| |
|
|
| T |
25559665 |
gattgacccaaaggattgcttcagattcgaattgaaggaattcgaatttggggttttaattc |
25559604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 214
Target Start/End: Complemental strand, 40557170 - 40557085
Alignment:
| Q |
128 |
agaaccctaattttgggttttttgttatgaaaccaagccttatatacgtgtcacggtggagccacataggatcgtccacgtgtgcaa |
214 |
Q |
| |
|
|||||||||||||||||| || || ||||| | | |||||||||| ||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40557170 |
agaaccctaattttgggtgttctgatatgag-caatgccttatatatgtgccacggtgtagccacataggatcgtccacgtgtgcaa |
40557085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University