View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5480_low_3 (Length: 258)
Name: NF5480_low_3
Description: NF5480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5480_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 42 - 247
Target Start/End: Original strand, 34432647 - 34432853
Alignment:
| Q |
42 |
gtgagaagatgaaaaggatgtgaacagattggagtgagagggaatttaacatgaatttaaggagtaggagatgagagaagagannnnnnnnatttaatag |
141 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
34432647 |
gtgagaagatgaaaaggatatgaacagattggagtgagagggaatttaacatgaatttaaggagtaggagatgagagaagaaattttatttatttaatag |
34432746 |
T |
 |
| Q |
142 |
ataaataaatttaggtgagttgggctcattagagtccggacatgtctcaaagctc-aaaaaacgtgttgacaaaaatacttgtagattacaccaacaaag |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34432747 |
ataaataaatttaggtgagttgggctcattagagtccggacatgtctcaaagctcaaaaaaacgtgttgacaaaaatacttgtagattacaccaacaaag |
34432846 |
T |
 |
| Q |
241 |
tcttcat |
247 |
Q |
| |
|
||||||| |
|
|
| T |
34432847 |
tcttcat |
34432853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University