View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5480_low_5 (Length: 215)

Name: NF5480_low_5
Description: NF5480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5480_low_5
NF5480_low_5
[»] chr2 (3 HSPs)
chr2 (95-214)||(25559427-25559543)
chr2 (20-81)||(25559604-25559665)
chr2 (128-214)||(40557085-40557170)


Alignment Details
Target: chr2 (Bit Score: 57; Significance: 6e-24; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 95 - 214
Target Start/End: Complemental strand, 25559543 - 25559427
Alignment:
95 agagggagagagaggcgcgattgaagatgatgaagaaccctaattttgggttttttgttatgaaaccaagccttatatacgtgtcacggtggagccacat 194  Q
    |||| ||||||||||||||||||||  | |  |||||||||||||||||||||| || |||||  | | |||||||||||||| ||||||| ||||||||    
25559543 agagagagagagaggcgcgattgaatttca--aagaaccctaattttgggttttctgatatgag-caatgccttatatacgtgccacggtgtagccacat 25559447  T
195 aggatcgtccacgtgtgcaa 214  Q
    ||||||||||||||||||||    
25559446 aggatcgtccacgtgtgcaa 25559427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 20 - 81
Target Start/End: Complemental strand, 25559665 - 25559604
Alignment:
20 gattgacccagaggattgcttcagattcgaattgaaggaattggattttggggtttgaattc 81  Q
    |||||||||| ||||||||||||||||||||||||||||||| || |||||||||| |||||    
25559665 gattgacccaaaggattgcttcagattcgaattgaaggaattcgaatttggggttttaattc 25559604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 214
Target Start/End: Complemental strand, 40557170 - 40557085
Alignment:
128 agaaccctaattttgggttttttgttatgaaaccaagccttatatacgtgtcacggtggagccacataggatcgtccacgtgtgcaa 214  Q
    |||||||||||||||||| || || |||||  | | |||||||||| ||| ||||||| ||||||||||||||||||||||||||||    
40557170 agaaccctaattttgggtgttctgatatgag-caatgccttatatatgtgccacggtgtagccacataggatcgtccacgtgtgcaa 40557085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University