View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5481_low_10 (Length: 248)
Name: NF5481_low_10
Description: NF5481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5481_low_10 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 248
Target Start/End: Original strand, 36881905 - 36882136
Alignment:
| Q |
18 |
tcaaggtacttcaagtatagtgattgtgacaaagaatttatggaa-taagacaagacatactaataacggaaacgactttcttgcttgttcaatttttat |
116 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36881905 |
tcaaggtacatcaagtatagtgattgtgacaaagaatttatggaaataagacaagacatactaataacggaaacgactttcttgcttgttcaatttttat |
36882004 |
T |
 |
| Q |
117 |
aacagcatcagttttatagcaacatggtaatttaaaaatgtatatgttctcctaaacttcacagcgcatacaattttgtacttctgcaatgttctattga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36882005 |
aacagcatcagttttatagcaacatggtaatttaaaaatgtatatgttctcctgaatttcacagcgcatacaattttgtacttctgcaatgttctattga |
36882104 |
T |
 |
| Q |
217 |
ccttttttagcaaagttatgttgcaggtgatc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36882105 |
ccttttttagcaaagttatgttgcaggtgatc |
36882136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University