View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5482_low_5 (Length: 265)
Name: NF5482_low_5
Description: NF5482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5482_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 41123646 - 41123900
Alignment:
| Q |
1 |
cacagatggtgcaacctgtggttcttcatatatatatgcagagttctttgctacaatgtatgatattgatataacctatttgtataattggtggagtctc |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41123646 |
cacagatggtgcaacctgtggttctccatat----atgcagagttctttgctacaatgtatgatattgatataacctatttgtataattggtggagtctc |
41123741 |
T |
 |
| Q |
101 |
tatagctcgaatgtgattctaagtaattggtggtttggagtcttactattagatggagaaactgtttgcagtcatatgagtttttaagtttccaacatct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41123742 |
tatagctcgaatgtgattctaagtaattgatggtttggagtcttactattagatggagaaactgtttgcagtcatatgagtttttaagtttccaacatct |
41123841 |
T |
 |
| Q |
201 |
atagcgatagggaagacaattattgtacttcttctcatggctctcattggtgctcaatc |
259 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41123842 |
atagccatagggaagacaattattgtacttcttctcatggctctcattggtgctcaatc |
41123900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University