View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5484_high_5 (Length: 381)
Name: NF5484_high_5
Description: NF5484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5484_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 153 - 363
Target Start/End: Original strand, 35334985 - 35335195
Alignment:
| Q |
153 |
tgatatgaaagaacaaagcaaacatgaaagttaagagacaaaccaattatagatgtagcacccaaaagggtgtcacctccggcatgcttgcaagatttga |
252 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35334985 |
tgatatgaaagaacaaagcaatcatgaaagttaagagacaaaccaattatagatgtagcacccaaaagggtgtcacctccagcatgcttgcaagatttga |
35335084 |
T |
|
| Q |
253 |
cataaacaacaccttgaacagctattaagcttctaggatggaaaattgaacgcagtggtgtgtgagcaggggcaagagcaggagtgtgatgatggtgggg |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35335085 |
cataaacaacaccttgaacagctattaagcttctaggatggaaaattgaacgcagtggtgtgtgagcaggggcaagagcaggagtgtgatgatggcgggg |
35335184 |
T |
|
| Q |
353 |
gtgagggttgg |
363 |
Q |
| |
|
||||||||||| |
|
|
| T |
35335185 |
gtgagggttgg |
35335195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 188 - 278
Target Start/End: Complemental strand, 16592257 - 16592167
Alignment:
| Q |
188 |
agacaaaccaattatagatgtagcacccaaaagggtgtcacctccggcatgcttgcaagatttgacataaacaacaccttgaacagctatt |
278 |
Q |
| |
|
|||||||||| | | |||||||||| | ||||||||||| |||| ||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
16592257 |
agacaaaccattaagagatgtagcattcgaaagggtgtcaactccagcatgcttgcatgatttgacataaacaacaccttcaacagctatt |
16592167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 234 - 289
Target Start/End: Original strand, 35327002 - 35327057
Alignment:
| Q |
234 |
gcatgcttgcaagatttgacataaacaacaccttgaacagctattaagcttctagg |
289 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35327002 |
gcatacttgcaagatttgacataaacaacaccttgaacagctataaagcttctagg |
35327057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 203 - 278
Target Start/End: Complemental strand, 16602746 - 16602671
Alignment:
| Q |
203 |
agatgtagcacccaaaagggtgtcacctccggcatgcttgcaagatttgacataaacaacaccttgaacagctatt |
278 |
Q |
| |
|
|||||||||| | ||||||| ||| |||| ||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
16602746 |
agatgtagcattcgaaagggtttcaactccagcatgcttgcatgatttgacataaacaacaccttcaacagctatt |
16602671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 239 - 272
Target Start/End: Complemental strand, 5342519 - 5342486
Alignment:
| Q |
239 |
cttgcaagatttgacataaacaacaccttgaaca |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5342519 |
cttgcaagatttgacataaacaacaccttgaaca |
5342486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 17 - 53
Target Start/End: Original strand, 35334849 - 35334885
Alignment:
| Q |
17 |
aaaatatgtccattatcgataatcatgcaactttatt |
53 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
35334849 |
aaaatatgtccattctcggtaatcatgcaactttatt |
35334885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 221 - 286
Target Start/End: Original strand, 3175390 - 3175455
Alignment:
| Q |
221 |
ggtgtcacctccggcatgcttgcaagatttgacataaacaacaccttgaacagctattaagcttct |
286 |
Q |
| |
|
||||||| | |||| ||| ||||| |||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
3175390 |
ggtgtcaacaccggtatggttgcatgatttgacataaacaacaccttcaacagctatcaagcttct |
3175455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 240 - 286
Target Start/End: Complemental strand, 20964511 - 20964465
Alignment:
| Q |
240 |
ttgcaagatttgacataaacaacaccttgaacagctattaagcttct |
286 |
Q |
| |
|
||||||||||||||||||||||| |||| |||| |||| |||||||| |
|
|
| T |
20964511 |
ttgcaagatttgacataaacaactccttcaacaactatcaagcttct |
20964465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 240 - 272
Target Start/End: Original strand, 38542112 - 38542144
Alignment:
| Q |
240 |
ttgcaagatttgacataaacaacaccttgaaca |
272 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
38542112 |
ttgcaagatttgacataaacaacacctcgaaca |
38542144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University