View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5484_low_11 (Length: 211)
Name: NF5484_low_11
Description: NF5484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5484_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 20 - 194
Target Start/End: Original strand, 9212159 - 9212333
Alignment:
| Q |
20 |
atgtccacttcaaaccatgtatccttcttgctactacttgtgattattatgtgtttcaataattcaacttttggtagtagagcctctatttcactcccca |
119 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9212159 |
atgtccacttcaaaccatgtatctttgttgctactacttgtgattattatgtgtttcaataattcaacttttggtagtagagcctctatttcactcccca |
9212258 |
T |
|
| Q |
120 |
ctgaacctccaccagaaaaaatacttttactctcggttgaaaatgatttaccagaaaattcaggagagttatact |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9212259 |
ctgaacctccaccagaaaaaatacttttactctcggttgaaaatgatttaccagaaaattcaggagagttatact |
9212333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 28 - 100
Target Start/End: Complemental strand, 29252875 - 29252803
Alignment:
| Q |
28 |
ttcaaaccatgtatccttcttgctactacttgtgattattatgtgtttcaataattcaacttttggtagtaga |
100 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||| ||||||||||| ||||||||| ||||| |||||| |
|
|
| T |
29252875 |
ttcaatccatgtatccttcttgttactacttgtgattgctatgtgtttcagtaattcaacctttggcagtaga |
29252803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 54 - 109
Target Start/End: Complemental strand, 9893025 - 9892970
Alignment:
| Q |
54 |
tacttgtgattattatgtgtttcaataattcaacttttggtagtagagcctctatt |
109 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9893025 |
tacttgtgattgttatgtctttcaataattcaacttttggtagtagagtctctatt |
9892970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 34 - 114
Target Start/End: Complemental strand, 7250431 - 7250351
Alignment:
| Q |
34 |
ccatgtatccttcttgctactacttgtgattattatgtgtttcaataattcaacttttggtagtagagcctctatttcact |
114 |
Q |
| |
|
||||||||||||||| |||||||| ||||| ||||||||||||||||| ||||||||| || |||| ||||||| |||| |
|
|
| T |
7250431 |
ccatgtatccttctttttactacttttgattgctatgtgtttcaataatttaacttttggcagcagagtctctattccact |
7250351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University