View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5485_high_8 (Length: 245)
Name: NF5485_high_8
Description: NF5485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5485_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 36964897 - 36965130
Alignment:
| Q |
1 |
cgtaaaggtataggttacaaaaatgacaaatatgcaacattagttatttgtgtctcaattttgatgtctacaaccttaactaaaaacatttgtaacgttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
36964897 |
cgtaaaggtataggttacaaaaatgacaaatatgcaacattagttatttgtgtctcaattttgatgtctacaaccttacctaaaatcatttgtaacgttt |
36964996 |
T |
 |
| Q |
101 |
taacaatttggtcataatctgaaatttcaattcattgcagggagagcataaagtggtctatgatgataataaaccaactgagtttttccaatggattgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36964997 |
taacaatttggtcataatctgaaatttcaattcattgcagggagagcataaagtggtctatgatgataataaaccaactgagtttttccaatggattgat |
36965096 |
T |
 |
| Q |
201 |
ctgaaaaaggtaattccatgttttgttgagtata |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
36965097 |
ctgaaaaaggtaattccatgttttgttgaatata |
36965130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University