View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5485_high_9 (Length: 238)
Name: NF5485_high_9
Description: NF5485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5485_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 31 - 221
Target Start/End: Complemental strand, 36964874 - 36964684
Alignment:
| Q |
31 |
ttttacatgtgaaaatatttagacatatcaatctgaaaagggattttaacagctataaatttcgagttaaatatatcaccgtggcagggtcataatcagt |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36964874 |
ttttacatgtgaaaatatttagacatatcaatctgaaaagggattttaacagctataaatttcgagttaaatatatcaccg-ggcagggtcataatcagt |
36964776 |
T |
 |
| Q |
131 |
aatctcggcaagctctgaccatttaatacgaactttcttcccaat-aatatatctaaagttgctgctttagcaggttcaacttgaacagaat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36964775 |
aatctcggcaagctctgaccatttaatacgaagtttcttcccaatcaatatatctaaagttgctgctttagcaggttcaacttgaacagaat |
36964684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University