View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5486_high_18 (Length: 210)
Name: NF5486_high_18
Description: NF5486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5486_high_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 58; Significance: 1e-24; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 18 - 87
Target Start/End: Original strand, 28795686 - 28795755
Alignment:
| Q |
18 |
gtggggatagatcatcttcaactaaggattcatctgattcttctgaggaaacaactctagcaacaactct |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||| |
|
|
| T |
28795686 |
gtggggatagatcatcttcaactaaggattcatctgattcttttcaggaaacaactcttgcaacaactct |
28795755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 87
Target Start/End: Original strand, 28797276 - 28797344
Alignment:
| Q |
19 |
tggggatagatcatcttcaactaaggattcatctgattcttctgaggaaacaactctagcaacaactct |
87 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||| | ||||||||||||| ||||||||||| |
|
|
| T |
28797276 |
tggggatagatcttcttcaacaaaggattcatctgattcttttcaggaaacaactcttgcaacaactct |
28797344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 87
Target Start/End: Original strand, 28780423 - 28780491
Alignment:
| Q |
19 |
tggggatagatcatcttcaactaaggattcatctgattcttctgaggaaacaactctagcaacaactct |
87 |
Q |
| |
|
|||| ||||||| | ||||||||||||||||||| |||||| | ||||||||||||| ||||||||||| |
|
|
| T |
28780423 |
tgggaatagatcgtattcaactaaggattcatctaattcttttaaggaaacaactcttgcaacaactct |
28780491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University