View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5486_low_10 (Length: 263)
Name: NF5486_low_10
Description: NF5486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5486_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 74 - 247
Target Start/End: Original strand, 41526650 - 41526823
Alignment:
| Q |
74 |
aagggaaaagtggctgctgctaatgtgtctgatggcgtaaagcggaaaggggctcctgctatgaggataggtgattttgaattgttgatttaagtggtga |
173 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||| |||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41526650 |
aaggggaaaggggctgctgctaatgtgtctgatggcgtaaaacggaaaggggctgctgctaagaggataggtgattttgaattgttgatttaagtggtga |
41526749 |
T |
|
| Q |
174 |
aaaaggctagttttgatggtaccatggcaacaattaactccgatgccttcaagataaaaatgaaggagtgtttt |
247 |
Q |
| |
|
|||| |||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41526750 |
aaaaagctagttttgatggtaccatggcagcggttaactccgatgccttcaagataaaaatgaaggagtgtttt |
41526823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University