View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5486_low_12 (Length: 242)

Name: NF5486_low_12
Description: NF5486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5486_low_12
NF5486_low_12
[»] chr1 (1 HSPs)
chr1 (21-192)||(33120521-33120699)


Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 21 - 192
Target Start/End: Complemental strand, 33120699 - 33120521
Alignment:
21 tcgatactttttaatatgtttaattgtttaattaaattcgaga-------taattaattttattaactatgtagggagcataagcaagaactctcccact 113  Q
    ||||||||||||||||| |||||||| ||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||    
33120699 tcgatactttttaatatttttaattgcttaattaaattcgagaatatgtataattaattttattaactatgtagggagcataagcaagaactctcccact 33120600  T
114 atggtcaaaagatcaacatcatcctcagtagactgaggaagcagatcacggtctgtcgtcaacaaataggtcagtaaat 192  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33120599 atggtcaaaagatcaacatcatcctcagtagactgaggaagcagatcacggtctgtcgtcaacaaataggtcagtaaat 33120521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University