View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5488-Insertion-7 (Length: 135)
Name: NF5488-Insertion-7
Description: NF5488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5488-Insertion-7 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 8e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 8e-53
Query Start/End: Original strand, 7 - 135
Target Start/End: Original strand, 49652854 - 49652981
Alignment:
| Q |
7 |
aaaaaatccagcaataaaatacccagaaacaaacccttcacttttatcacagtatccaaaagatcttcttcctctgtctctcgctctcacagtgtgtctc |
106 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49652854 |
aaaaaatccagcaataaaa-acccagaaacaaacccttcacttttatcacagtacccaaaacatcttcttcctctgtctcccgctctcacagtgtgtctc |
49652952 |
T |
|
| Q |
107 |
ttgttcacacttacggctgcaattccttt |
135 |
Q |
| |
|
|||||||||||||||| |||||||||||| |
|
|
| T |
49652953 |
ttgttcacacttacggttgcaattccttt |
49652981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 2e-19; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 79 - 135
Target Start/End: Complemental strand, 17510273 - 17510217
Alignment:
| Q |
79 |
tctgtctctcgctctcacagtgtgtctcttgttcacacttacggctgcaattccttt |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
17510273 |
tctgtctctcgctctcacagtgtgtctcttgttcacacttaccactgcaattccttt |
17510217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 16 - 56
Target Start/End: Complemental strand, 17514303 - 17514264
Alignment:
| Q |
16 |
agcaataaaatacccagaaacaaacccttcacttttatcac |
56 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
17514303 |
agcaataaaa-acccataaacaaacccttcacttttatcac |
17514264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University