View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5489-Insertion-13 (Length: 122)
Name: NF5489-Insertion-13
Description: NF5489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5489-Insertion-13 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 1e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 1e-41
Query Start/End: Original strand, 9 - 122
Target Start/End: Original strand, 19823822 - 19823930
Alignment:
| Q |
9 |
tattaataatatacaagatcaaccaaaaatatctcttgtccttgctcttagaagataccataccagtgaacaagaggttaggttttggtcatgtgacctt |
108 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19823822 |
tattaataatatacaagatcaatcaaaaatatctcttgtccttgctctgagaagatac-----cagtgaacaagaggttaggttttggtcatgtgacctt |
19823916 |
T |
|
| Q |
109 |
ttccaaaagttatt |
122 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
19823917 |
ttccaaaagttatt |
19823930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University