View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5489_high_20 (Length: 329)

Name: NF5489_high_20
Description: NF5489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5489_high_20
NF5489_high_20
[»] chr5 (2 HSPs)
chr5 (15-139)||(17913944-17914061)
chr5 (250-319)||(17910391-17910460)


Alignment Details
Target: chr5 (Bit Score: 86; Significance: 4e-41; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 15 - 139
Target Start/End: Complemental strand, 17914061 - 17913944
Alignment:
15 gataggttgctgaggagacatggcggagggattaactaggagaagggagaatttgctatgaagaagagagtaagagagaagcgcgaataaggaaggtata 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   || |||||||||||||||||||||| ||||||||        
17914061 gataggttgctgaggagacatggcggagggattaactaggagaagggagaatttgctat---gacgagagtaagagagaagcgcgaacaaggaagg---- 17913969  T
115 tatatgattagggttttcaaagttt 139  Q
    |||||||||||||||||||||||||    
17913968 tatatgattagggttttcaaagttt 17913944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 250 - 319
Target Start/End: Complemental strand, 17910460 - 17910391
Alignment:
250 cttgggaagccttttcattcaaatcatgacacacttacccaaccagtctcttttagatgtgggtgcatgt 319  Q
    ||||||||||||||||||||||||||| |||||||| |||||||||| ||||||||||||||||||||||    
17910460 cttgggaagccttttcattcaaatcataacacacttgcccaaccagtatcttttagatgtgggtgcatgt 17910391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University