View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5489_high_20 (Length: 329)
Name: NF5489_high_20
Description: NF5489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5489_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 4e-41; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 15 - 139
Target Start/End: Complemental strand, 17914061 - 17913944
Alignment:
| Q |
15 |
gataggttgctgaggagacatggcggagggattaactaggagaagggagaatttgctatgaagaagagagtaagagagaagcgcgaataaggaaggtata |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |||||||| |
|
|
| T |
17914061 |
gataggttgctgaggagacatggcggagggattaactaggagaagggagaatttgctat---gacgagagtaagagagaagcgcgaacaaggaagg---- |
17913969 |
T |
 |
| Q |
115 |
tatatgattagggttttcaaagttt |
139 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
17913968 |
tatatgattagggttttcaaagttt |
17913944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 250 - 319
Target Start/End: Complemental strand, 17910460 - 17910391
Alignment:
| Q |
250 |
cttgggaagccttttcattcaaatcatgacacacttacccaaccagtctcttttagatgtgggtgcatgt |
319 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
17910460 |
cttgggaagccttttcattcaaatcataacacacttgcccaaccagtatcttttagatgtgggtgcatgt |
17910391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University