View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5489_high_23 (Length: 289)
Name: NF5489_high_23
Description: NF5489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5489_high_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 165 - 278
Target Start/End: Complemental strand, 4068238 - 4068125
Alignment:
| Q |
165 |
gtgttcttcatgtttgaacattgtacccgtgtttgtccttccttttgggttttgattaataaaattcagttaattacagaaagaatgaaaagctaccgat |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4068238 |
gtgttcttcatgtttgaacattgtacccgtgtttgtccttccttttgggttttgattaataaaattcagttaattacagcaagaatgaaaagctaccgat |
4068139 |
T |
|
| Q |
265 |
gattcacaaccttt |
278 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
4068138 |
gattcacaaccttt |
4068125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 4068426 - 4068286
Alignment:
| Q |
18 |
gttggagccttggtttgaagccacaatgaaagcttcagaaggtggtttgtgtttttggaagcaatgcaaggtttgttagagactattaacacttgagtag |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
4068426 |
gttggagccttggtttgaagccaaaatgaaagcttcagaaggtggtttgtgtttttggaagcaatgcaagg-ttgtta----------------gagtag |
4068344 |
T |
|
| Q |
118 |
cttgttaagttggtgtatcttttgcatgttatgctagtttgataccggtgttcttcat |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4068343 |
cttgttaagttggtgtatcttttgcatgttatgctagtttgataccggtgtttttcat |
4068286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University