View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5489_high_26 (Length: 258)
Name: NF5489_high_26
Description: NF5489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5489_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 20 - 129
Target Start/End: Complemental strand, 6123228 - 6123119
Alignment:
| Q |
20 |
gatggctcaagcctcagaagaagagttactttgctttgcaactccctaaacggtggtgggtttttgggcttgaccttgctcttcataatgatatagatgt |
119 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6123228 |
gatggctcatgcctcagaagaagagttactttgctttgcaactccctaaacggtggtgggtttttgggcttgaccttgctcttcataatgatatcgatgt |
6123129 |
T |
 |
| Q |
120 |
gtaccaattc |
129 |
Q |
| |
|
|||||||||| |
|
|
| T |
6123128 |
gtaccaattc |
6123119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 140 - 248
Target Start/End: Complemental strand, 6123041 - 6122933
Alignment:
| Q |
140 |
tttaagtttgcttcataaagtctctactgtttaatgtgattttacttacataatttgtagagaattctttaagttttcattattagtcattcgtttgttg |
239 |
Q |
| |
|
|||||| ||||||||||||||||||| ||| ||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |||| || |
|
|
| T |
6123041 |
tttaagcttgcttcataaagtctctagtgtctaatgtgattttacttacataatttgtgcagaattctttaccttttcattattagtcattcatttgctg |
6122942 |
T |
 |
| Q |
240 |
ttgcctttg |
248 |
Q |
| |
|
||||||||| |
|
|
| T |
6122941 |
ttgcctttg |
6122933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University