View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5489_high_32 (Length: 243)
Name: NF5489_high_32
Description: NF5489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5489_high_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 26937013 - 26936787
Alignment:
| Q |
1 |
atatccacaaatcctttttcatcattgataagttttgtataagctgaaaatatgcagcat--tttgtcaccatcaagaattttcaattacttggatgatc |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26937013 |
atatccacaaatcctttttcatcattgataagttttgtataagctgaaaatatgcagcatattttgtcaccgtcaagaattttcaattacttggatgatc |
26936914 |
T |
 |
| Q |
99 |
tatgaatattggaaccaaccaaaactgtgtatacatgttaaaataaatgatttctgtatctttttctttatttgttgacagatgaataaaactgaactta |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26936913 |
tatgaatattggaaccaaccaaaactgtgtatacatgttaaaataaatggtttctgtatctttttctttattttttgacagatgaataaaactgaactta |
26936814 |
T |
 |
| Q |
199 |
actttcttcaactgctcatgaatttct |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
26936813 |
actttcttcaactgctcatgaatttct |
26936787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University