View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5489_low_14 (Length: 441)
Name: NF5489_low_14
Description: NF5489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5489_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 158 - 428
Target Start/End: Original strand, 40953647 - 40953917
Alignment:
| Q |
158 |
ttctataactctcttttttattgaaaaatgtttgtcgttagtaatagtatgttaggtacgtgttttgaaccatggacctcgttctcacatccactgtgat |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40953647 |
ttctataactctcttttttattgaaaaatgtttgtagttagtaatagtatgttaggtacgtgttttgaaccatggacctcgttctcacatccactgtgat |
40953746 |
T |
|
| Q |
258 |
gtaccataatcagtgattcatatttcaatataagnnnnnnnnnnnnnnnngtaagaacgttgtattaaaatttgaatcgtctgatatcgatccaacaaca |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40953747 |
gtaccataatcagtgattcatatttcaatataagtttttatttttattttgtaaaaacgttgtattaaaatttgaatcgtctgatatcgatccaacaaca |
40953846 |
T |
|
| Q |
358 |
atagatgttgtgaccgtatgaatgcagtaaatgttgatggcaataatccaatctccgtagactacgccttc |
428 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40953847 |
atagatgttgtgaccgtatgaatgcagtaaatgttgatggcaacaatccaatctccgtagactacgccttc |
40953917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 18 - 145
Target Start/End: Original strand, 40953530 - 40953657
Alignment:
| Q |
18 |
aggccctcaatttatttcagtaacccagttgataaggaacataaattagacaaaatatagcattgttgaaattaattacacggtaaccccacacaatatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40953530 |
aggccctcaatttatttcagtaacccagttgataaggaacataaattagacaaaatatagcattgttgaaattaattacacagtaaccccacacaatatt |
40953629 |
T |
|
| Q |
118 |
catattattatttgttcttctataactc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
40953630 |
catattattatttgttcttctataactc |
40953657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University