View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5489_low_19 (Length: 332)
Name: NF5489_low_19
Description: NF5489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5489_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 71; Significance: 4e-32; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 49 - 139
Target Start/End: Complemental strand, 48966463 - 48966374
Alignment:
| Q |
49 |
agaatataacctcaatatcatagtaagatgatgatttgatagattgattagcatgaaaattttggtaaaggtcattcatctaacatatcac |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48966463 |
agaatataacctcaatatcatagtaagatgatgata-gattgattgattagcatgaaaattttggtaaaggtcattcatctaatatatcac |
48966374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 269 - 313
Target Start/End: Complemental strand, 48966246 - 48966202
Alignment:
| Q |
269 |
atattacatgacacatgagagtccattgaagcccgaactcacctc |
313 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
48966246 |
atattacatgacacatgagagttcattgaaacccgaactcacctc |
48966202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 213 - 274
Target Start/End: Complemental strand, 48966317 - 48966260
Alignment:
| Q |
213 |
catataatcactcaacgaataattaagatgataactgagttcattatgtcaaagctatatta |
274 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
48966317 |
catataatcactcaacgaataa----gatgataacagagttcattatgtcaaagctaaatta |
48966260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 15 - 50
Target Start/End: Complemental strand, 48966531 - 48966496
Alignment:
| Q |
15 |
aataataattaaagaatgagcacgttactttaggag |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
48966531 |
aataataattaaagaatgagcacgttactttaggag |
48966496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University