View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5489_low_26 (Length: 258)

Name: NF5489_low_26
Description: NF5489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5489_low_26
NF5489_low_26
[»] chr1 (2 HSPs)
chr1 (20-129)||(6123119-6123228)
chr1 (140-248)||(6122933-6123041)


Alignment Details
Target: chr1 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 20 - 129
Target Start/End: Complemental strand, 6123228 - 6123119
Alignment:
20 gatggctcaagcctcagaagaagagttactttgctttgcaactccctaaacggtggtgggtttttgggcttgaccttgctcttcataatgatatagatgt 119  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
6123228 gatggctcatgcctcagaagaagagttactttgctttgcaactccctaaacggtggtgggtttttgggcttgaccttgctcttcataatgatatcgatgt 6123129  T
120 gtaccaattc 129  Q
    ||||||||||    
6123128 gtaccaattc 6123119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 140 - 248
Target Start/End: Complemental strand, 6123041 - 6122933
Alignment:
140 tttaagtttgcttcataaagtctctactgtttaatgtgattttacttacataatttgtagagaattctttaagttttcattattagtcattcgtttgttg 239  Q
    |||||| ||||||||||||||||||| ||| |||||||||||||||||||||||||||  |||||||||||  ||||||||||||||||||| |||| ||    
6123041 tttaagcttgcttcataaagtctctagtgtctaatgtgattttacttacataatttgtgcagaattctttaccttttcattattagtcattcatttgctg 6122942  T
240 ttgcctttg 248  Q
    |||||||||    
6122941 ttgcctttg 6122933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University