View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5489_low_34 (Length: 241)
Name: NF5489_low_34
Description: NF5489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5489_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 17907188 - 17906953
Alignment:
| Q |
1 |
tattcccatgttaggataaattttggtttgagggaagaataccacgagaatgttgttcttgtaaatgataaagggaacaactacaacttgtggaactcct |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17907188 |
tattcccatgttaggataaagtttggtttgagcgaagaataccacgagaatgttgttcttgtaaatgataaagggaacaactacaacttgtggaactcct |
17907089 |
T |
 |
| Q |
101 |
tacgcttccgctcactacactccacatt-------gaatctactaatatgctccatagtcaatttgcaatcttccccgagaaggtaattgagtaaggatg |
193 |
Q |
| |
|
||||||||| | |||| ||||||||||| |||||| || ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17907088 |
tacgcttccccccactgcactccacattgaatattgaatcttctgatatgctccatagtcaatttgcaatcttccccgagaaggtagttgagtaaggaga |
17906989 |
T |
 |
| Q |
194 |
cttataacctttgagcagaggcaccaatttgatgat |
229 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||| |
|
|
| T |
17906988 |
cttataacctttgagcagaggcactaatttgttgat |
17906953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University