View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5489_low_39 (Length: 228)

Name: NF5489_low_39
Description: NF5489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5489_low_39
NF5489_low_39
[»] chr4 (1 HSPs)
chr4 (187-228)||(31805245-31805286)


Alignment Details
Target: chr4 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 187 - 228
Target Start/End: Original strand, 31805245 - 31805286
Alignment:
187 tagataatagtgttattttagagcagtgtttaattatttgtt 228  Q
    ||||||||||||||||||||||||||||||||||||||||||    
31805245 tagataatagtgttattttagagcagtgtttaattatttgtt 31805286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University