View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5489_low_40 (Length: 222)
Name: NF5489_low_40
Description: NF5489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5489_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 120 - 205
Target Start/End: Original strand, 28791534 - 28791619
Alignment:
| Q |
120 |
gattagataggttttttcttcaaaatatctttcactttcaatattacttgactggatgattccgttgatagacttgagatcatctt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28791534 |
gattagataggttttttcttcaaaatatctttcactttcaatattacttgactggatgattccgttgatagacttgagatcatctt |
28791619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University