View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5489_low_7 (Length: 491)
Name: NF5489_low_7
Description: NF5489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5489_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 151; Significance: 1e-79; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 151; E-Value: 1e-79
Query Start/End: Original strand, 277 - 458
Target Start/End: Complemental strand, 384959 - 384776
Alignment:
| Q |
277 |
ttttaccattacatcacattaaagggctttcagttgaacagtgatagttattatatcctaaacattggtttatgtaagacaggag---atactactcaat |
373 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
384959 |
ttttacaattacatcacattaaagggctttcacttgaacagtgatagttattatatcctaatcattggtttatgtaagacaggaggagata-tactcaat |
384861 |
T |
 |
| Q |
374 |
tagccatacccttgttgagacggttgccacattattttgacatttacactctcactgacttgcataactcagtcatacacaggtt |
458 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
384860 |
tagccatacccttgttgagacggttgccacattattttgacatttacactctcactgacttgcataactcagtcatacacaggtt |
384776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 86 - 184
Target Start/End: Complemental strand, 385537 - 385439
Alignment:
| Q |
86 |
actatacagaatagaatgcctcggtaattatttttgtttgaaaaacatggtggcactgagagggttataagcgtaattttgaaaacccttttcgttgac |
184 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
385537 |
actatacagaatagaatgcctaggtaattatttttgtttgaaaaacctggtggcactgagagggttataagcgtaattttgaaaacccttttcgttgac |
385439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 23 - 62
Target Start/End: Complemental strand, 385617 - 385578
Alignment:
| Q |
23 |
atatagtagggggaggcctgtacccataacctcaaggaaa |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
385617 |
atatagtagggggaggcctgtacccataacctcaaggaaa |
385578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 23 - 55
Target Start/End: Original strand, 38729963 - 38729995
Alignment:
| Q |
23 |
atatagtagggggaggcctgtacccataacctc |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38729963 |
atatagtagggggaggcctgtacccataacctc |
38729995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University