View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5490_high_12 (Length: 249)
Name: NF5490_high_12
Description: NF5490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5490_high_12 |
 |  |
|
| [»] scaffold0542 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0542 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: scaffold0542
Description:
Target: scaffold0542; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 7309 - 7535
Alignment:
| Q |
1 |
tgtaagtaggtttatcttctccagccataatcacaagtacttctgggtcagaattaatcttctctatgttcttggacattacctgtttcatttcttcatc |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7309 |
tgtaagttggtttatcttctccagccataatcacaagtacttctggctcagaattaatcttctctatgttcttggacattacctgtttcatttcttcatc |
7408 |
T |
 |
| Q |
101 |
tgaatttgatgatgattgagaagaagaaccacgttttttgtaggagcatacaaggatcaccaatgcaactgaaattaaaattagcattatggctaagcca |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7409 |
tgaatttgat---gattgagaagaagaaccacgttttttgtaggagcatacaaggatcaccaatgcaactgaaattaaaattagcattatggctaagcct |
7505 |
T |
 |
| Q |
201 |
ccaaatagatatggaattggagattgccat |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7506 |
ccaaatagatatggaattggagattgccat |
7535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University