View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5490_high_13 (Length: 225)
Name: NF5490_high_13
Description: NF5490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5490_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 16 - 204
Target Start/End: Complemental strand, 44689910 - 44689722
Alignment:
| Q |
16 |
attatactgtcggggaaacatctttttagtaccatgataagttaagtttacctgattaaactgatcccttgtgagaggtatatgtctaactcnnnnnnnt |
115 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44689910 |
attacactgtcggggaaacatctttttagtaccatgataagttaagtttacctgattaaactgatcccttgtgagaggtatatgtctaactcaaaaaaat |
44689811 |
T |
 |
| Q |
116 |
tagcatacttgtataatcatgttttttgtttggtacaaaatgacctgcattattggctattcattctttcaataaaaatttgttgctat |
204 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44689810 |
tagcatacttgtataatcatcttttttgtttggtacaaaatgacctgcattattggctattcattctttcagtaaaaatttgttgctat |
44689722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 16 - 184
Target Start/End: Complemental strand, 44680645 - 44680476
Alignment:
| Q |
16 |
attatactgtcggggaaacatctttttagtaccatgataagttaagtttacctgattaaactgatcccttgtgagaggtatatgtctaactcnnnnnnnt |
115 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| ||||||| ||| |||||||||| | |
|
|
| T |
44680645 |
attacactgtcggggaaacatctttttagtaccatgataagttaagtttacctgattaaattgagccctggtgagagttatgtgtctaactc--aaaaat |
44680548 |
T |
 |
| Q |
116 |
tagcatacttgtataatcatgttttttgtttggtacaaaatga---cctgcattattggctattcattcttt |
184 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
44680547 |
aagcatacttgtataatcaagttttttgtttggtacaaaatgattttctgcattattggctcctcattcttt |
44680476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 21 - 159
Target Start/End: Original strand, 41983667 - 41983801
Alignment:
| Q |
21 |
actgtcggggaaacatctttttagtaccatgataagttaagtttacctgattaaactgatcccttgtgagaggtatatgtctaactcnnnnnnnttagca |
120 |
Q |
| |
|
||||| ||||||| ||||||||||||||| ||||||||| | ||| || |||||| ||| |||| ||||| |||| ||| ||||| || ||| |
|
|
| T |
41983667 |
actgttggggaaatatctttttagtaccacgataagttatgcttatctaattaaattgagccctcgtgag--gtatgtgtttaact--taaaaatttgca |
41983762 |
T |
 |
| Q |
121 |
tacttgtataatcatgttttttgtttggtacaaaatgac |
159 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41983763 |
tacttgtataatcaagttttttgtttggtacaaaatgac |
41983801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University