View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5490_high_14 (Length: 216)
Name: NF5490_high_14
Description: NF5490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5490_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 16 - 198
Target Start/End: Original strand, 7594043 - 7594225
Alignment:
| Q |
16 |
aattctagagcgggcgtgtgtttcaccatagagaaagttgtagagtatcacaagactttttgcgagcacatgatcctcccacacttccttactagtgtgt |
115 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7594043 |
aattctagagtgggcgtgtgtttcaccatagagaaagttgtagagtatcacaagactttttgcaagcacatgatcctcccacacttccttactagtgtgt |
7594142 |
T |
 |
| Q |
116 |
gaaccactcctaaggtgcgtttcagtggcatcgagacgatgcatactccttttccacattccatttaatcgacgaatcttctg |
198 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7594143 |
gaaccactcctaaggtgcgtttcggtggcatcgagacgatgcatactccttttccacattccatttaatcgacgaatcttctg |
7594225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University