View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5490_high_15 (Length: 214)
Name: NF5490_high_15
Description: NF5490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5490_high_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 13 - 108
Target Start/End: Complemental strand, 35096027 - 35095932
Alignment:
| Q |
13 |
aatatgcaattccatctctctccaccttccattgctgttcttgatcaacctcagtaacatctcatcttccttctatcgctgcacgccgcaccttaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35096027 |
aatatgcaattccatctctctccaccttccatagctgttcttgatcaacctcagtaacatctcatcttccttctagcgctgcacgccgcaccttaa |
35095932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 159 - 214
Target Start/End: Complemental strand, 35095881 - 35095826
Alignment:
| Q |
159 |
ccttcactatattttattattatggcaccatcattcttcatcactttcttcttttc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35095881 |
ccttcactatattttattattatggcaccatcattcttcatcactttcttcttttc |
35095826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University