View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5490_high_8 (Length: 328)
Name: NF5490_high_8
Description: NF5490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5490_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-109; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 92 - 311
Target Start/End: Original strand, 10553823 - 10554040
Alignment:
| Q |
92 |
taaagtgatgatttcagttgcctcagttgaatggatctcatatgtaatccttaagagaggcagacatggcttttgtaaaatcatatcatgttgatatcga |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10553823 |
taaagtgatgatttcagttgcctcagttgaatggatctcatatgtaatccttaagag--gcagacatggcttttgtaaaatcatatcatgttgatatcga |
10553920 |
T |
 |
| Q |
192 |
cagaaaaagtcagattttaatatcgatattcaatgtataaatatgaccttacattctattcaaaatacaagaacttgtataaaaatcaataaaagaaatt |
291 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10553921 |
cagaaaaagtcagattttgatatcgatattcaatgtataaatatgaccttacattctatccaaaatacaagaacttgtataaaaatcaataaaagaaatt |
10554020 |
T |
 |
| Q |
292 |
cagtaacatatctcacaagt |
311 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
10554021 |
cagtaacatatctcacaagt |
10554040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 7 - 41
Target Start/End: Original strand, 10553404 - 10553438
Alignment:
| Q |
7 |
gagagatgaattgcatgaataattcagaatgtaaa |
41 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
10553404 |
gagatatgaattgcatgaataattcagaatgtaaa |
10553438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University