View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5490_high_9 (Length: 276)
Name: NF5490_high_9
Description: NF5490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5490_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 25943905 - 25944171
Alignment:
| Q |
1 |
cttcactttccaaaaactccattttctttgtcccttttaaaggtaaaaccaaccaattttctttttccaagtcaaggataattgcttgctcttctccaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25943905 |
cttcactttccaaaaactccattttctttgtcccttttaaaggtaaaaccaaccaattttctttttccaagtcaaggataattgcttgctcttctccaca |
25944004 |
T |
|
| Q |
101 |
ggatgcaagctccaatgaaatcacaccaaagttag----nnnnnnnnngcttattgggtgtctttaatttcattcaaaattgtaactttgcaactggttt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25944005 |
ggatgcaagctccaatgaaatcacaccaaagttagtttttttttttttgcttattgggtgtctttaatttcattcaaaattgtaactttgcaactggttt |
25944104 |
T |
|
| Q |
197 |
gataaaaatatg--nnnnnnnnatcagcaacttttgcatcattgaagggccagagacggttcaggat |
261 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25944105 |
gataaaattatgttttttttttatcagcaacttttgcatcattgaagggccagagacggttcaggat |
25944171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University