View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5491-Insertion-11 (Length: 86)
Name: NF5491-Insertion-11
Description: NF5491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5491-Insertion-11 |
 |  |
|
| [»] scaffold0339 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0339 (Bit Score: 52; Significance: 2e-21; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 52; E-Value: 2e-21
Query Start/End: Original strand, 35 - 86
Target Start/End: Complemental strand, 15554 - 15503
Alignment:
| Q |
35 |
ccgcatcatggatgggattattgttcaagaaagttttaaacttagcatccag |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15554 |
ccgcatcatggatgggattattgttcaagaaagttttaaacttagcatccag |
15503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University