View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5491_high_13 (Length: 246)
Name: NF5491_high_13
Description: NF5491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5491_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 116 - 228
Target Start/End: Original strand, 36698489 - 36698601
Alignment:
| Q |
116 |
gaagttcaagttggactcaaatgtgttacttttatcctttgactttactatgttaataatcaacatatgtttatcattttcgtcaaatacatgtaaggaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36698489 |
gaagttcaagttggactcaaatgtgttacttttatcctttaactttactatgttaataatcaacatatgtttatcattttcgtcaaatacatgtaaggaa |
36698588 |
T |
 |
| Q |
216 |
gttggtgaaagat |
228 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36698589 |
gttggtgaaagat |
36698601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 36698374 - 36698439
Alignment:
| Q |
1 |
tttgatgttaaattgcgtgtcaatatattatttctcaaaaagaaaaggtgtagtatcatcacagtc |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36698374 |
tttgatgttaaattgcgtgtcaatatattatttctcaaaaagaaaaggtgtagtatcatcacagtc |
36698439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University