View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5491_low_20 (Length: 202)
Name: NF5491_low_20
Description: NF5491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5491_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 8074796 - 8074874
Alignment:
| Q |
1 |
taacattttatgcatgattattaaaaaattaaacaaattacacaggtgtcatcttttcaaatattagtcaaactaatgg |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8074796 |
taacattttatgcatgattattaaaaaattaaacaaattacacaggtgtcatcttttcaaatattagtcaaactaatgg |
8074874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 145 - 180
Target Start/End: Original strand, 8074927 - 8074962
Alignment:
| Q |
145 |
tgtcacgagaatcaatatttccaacgttctaaatct |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
8074927 |
tgtcacgagaatcaatatttccaacgttctaaatct |
8074962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University