View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5492_high_64 (Length: 236)
Name: NF5492_high_64
Description: NF5492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5492_high_64 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 43184892 - 43184649
Alignment:
| Q |
1 |
caagtcaaataagtagtgctagtattactccgcatttaatcatacttttagctttgattctacacacactctctctaaaacat--------ccctcatga |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43184892 |
caagtcaaataagtagtgctagtattactccgcatttaatcatacttttagctttgattctacacacactctctctaaaacatgtctaaatccctcatga |
43184793 |
T |
|
| Q |
93 |
tcaaattaatggccttgtattggcttttcaacagtggcaaatattatgaacctcaaaccctagaaatagggaaagaggcgatcgctttgagaaaggcaac |
192 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43184792 |
tcagattaatggccttgtattggcttttcaacagtggcaaatattatgaacctcaaaccctagaaatagggaaagaggcgatcgctttgagaaagacaac |
43184693 |
T |
|
| Q |
193 |
atacttaatttacactgtctctacatgcttcttaaaaatgatct |
236 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
43184692 |
atacttaatttacactgtttccacatgcttcttaaaaatgatct |
43184649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University