View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5492_high_66 (Length: 233)
Name: NF5492_high_66
Description: NF5492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5492_high_66 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 219
Target Start/End: Complemental strand, 11107507 - 11107307
Alignment:
| Q |
19 |
ggtaacaccctttgatgttgtagtgggaatgccttatcttattatgttgttttcttttagagaatcttaatcttgtagagttttattagtattgttgatg |
118 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11107507 |
ggtaacgccctttgatgttgtagtgggaatgccttatgttattatgttgttttcttttagagaatcttaatcttgtagagttttattagtattgttgatg |
11107408 |
T |
|
| Q |
119 |
ataatatcaaaatttagatcagaggaagtttcttttttatgagtaggggaagagttgttttcttgatggaaggggaagagttgttatattctagagatga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11107407 |
ataatatcaaaatttagatcagaggaagtttcttttttatgagtaggggaagagttgttttcttgatggaaggggaagagttgttatattctagagatga |
11107308 |
T |
|
| Q |
219 |
t |
219 |
Q |
| |
|
| |
|
|
| T |
11107307 |
t |
11107307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University